Prev. |  KEGG KO K01384 > 

RIKEN DNA Bank Human Resource - WNT11

Gene ID NCBI Gene 7481 |  KEGG hsa:7481
Gene Symbol WNT11
Protein Name Wnt family member 11
Synonyms HWNT11
Featured content Signaling pathways regulating pluripotency of stem cells (human)
Featured content Hippo signaling (human)
Featured content Hedgehog signaling (human)
Featured content Wnt signaling pathway (human)
Ortholog resource in our bank

  WNT11

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR402970 RBdS007H02 pGCAP10 NM_004626.2  
GGCAGGCGGCGTGCAGGACCAGCGGCGGCCGTGCAGGCGGAGGACTTCGGCGCGGCTCCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl