Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08812

HP ID(1) HP08812
Gene ID(2) 9882
Gene Symbol finder TBC1D4
Protein Name TBC1 domain family, member 4
RefSeq NM_014832.2
Length of RefSeq (bp) 6363
Chromosome 13q22.2
Reference DDBJ accession
UniGene Hs.210891

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS007E22 pGCAP10 GGGGGCTGCAGCGCTGGAGCCGGCGGCCGCGGGGACCCTCGGCGTGGTCCTCTGACCCTG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl