RIKEN DNA Bank Human Resource

RIKEN DNA Bank Human Resource - TBC1D4

Gene ID	NCBI Gene 9882 \| KEGG hsa:9882
Gene Symbol	TBC1D4
Protein Name	TBC1 domain family member 4
Synonyms	AS160\|NIDDM5

Link

Ortholog resource in our bank

TBC1D4

External database

human TBC1D4

Individualy Deposited Resource

Catalog number	Name of Resource	Description	CDS comparison
Catalog number	Name of Resource	Description	Refered (NCBI mRNA)	CDS status⁽¹⁾
RDB14986	pEGFP-C1-human TBC1D4	Expression vector of human TBC1 domain family member 4 (TBC1D4), fused with N-terminal EGFP, CMV promoter.

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	CDS comparison
	Clone name	Vector	Refered mRNA⁽¹⁾	CDS status
	5'-terminal sequence⁽²⁾
HKR402918	RBdS007E22	pGCAP10	NM_014832.2
HKR402918	GGGGGCTGCAGCGCTGGAGCCGGCGGCCGCGGGGACCCTCGGCGTGGTCCTCTGACCCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv

2024.09.29

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl