Prev. |  KEGG KO K17902 > 

RIKEN DNA Bank Human Resource - TBC1D4

Gene ID NCBI Gene 9882 |  KEGG hsa:9882
Gene Symbol TBC1D4
Protein Name TBC1 domain family member 4
Synonyms AS160|NIDDM5
Ortholog resource in our bank

  TBC1D4

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB14986 pEGFP-C1-human TBC1D4 Expression vector of human TBC1 domain family member 4 (TBC1D4), fused with N-terminal EGFP, CMV promoter.

webcatalog20220516.tab


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR402918 RBdS007E22 pGCAP10 NM_014832.2  
GGGGGCTGCAGCGCTGGAGCCGGCGGCCGCGGGGACCCTCGGCGTGGTCCTCTGACCCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2023.04.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl