Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08811

HP ID(1) HP08811
Gene ID(2) 51475
Gene Symbol finder CABP2
Protein Name calcium binding protein 2
RefSeq NM_016366.2
Length of RefSeq (bp) 957
Chromosome 11q13.1
Reference DDBJ accession
UniGene Hs.278984

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS007E12 pGCAP10 GAGTCTGGGGAGGCTGTGCTCTCCAGGGGGCCTTGGGCCCAAGTGGCTCCCCTCAGCAGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl