Prev. | 

RIKEN DNA Bank Human Resource - CABP2

Gene ID NCBI Gene 51475 |  KEGG hsa:51475
Gene Symbol CABP2
Protein Name calcium binding protein 2
Synonyms DFNB93
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR402908 RBdS007E12 pGCAP10 NM_016366.3 done
GAGTCTGGGGAGGCTGTGCTCTCCAGGGGGCCTTGGGCCCAAGTGGCTCCCCTCAGCAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl