Prev. | NRCD Clone W | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08806

HP ID(1) HP08806
Gene ID(2) 84128
Gene Symbol finder WDR75
Protein Name WD repeat domain 75
RefSeq NM_032168.1
Length of RefSeq (bp) 2777
Chromosome 2q32.2
Reference DDBJ accession
UniGene Hs.399984

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS007D05 pGCAP10 GATTCCGCTACTGCGCAAAGATGGTGGAGGAGGAGAACATCCGCGTGGTTCGTTGTGGCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl