Prev. |  KEGG KO K14552 > 

RIKEN DNA Bank Human Resource - WDR75

Gene ID NCBI Gene 84128 |  KEGG hsa:84128
Gene Symbol WDR75
Protein Name WD repeat domain 75
Synonyms NET16|UTP17
Ortholog resource in our bank

  WDR75

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001510 IRAK003M22 pCMV-SPORT6 BC006816 NM_032168 Partial
HGY029624 IRAK074A24 pBluescriptR BC040567 NM_032168

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE090805 M01C027A05 pDONR221 MGC03-A03 BC040567 ENST00000314761  
HGE090853 M01C027C05 pDONR221 MGC03-A03 BC040567 ENST00000314761  
HGE090901 M01C027E05 pDONR221 MGC03-A03 BC040567 ENST00000314761  
HGE090949 M01C027G05 pDONR221 MGC03-A03 BC040567 ENST00000314761  
HGE090997 M01C027I05 pDONR221 MGC03-A03 BC040567 ENST00000314761  
HGE091045 M01C027K05 pDONR221 MGC03-A03 BC040567 ENST00000314761  
HGE091093 M01C027M05 pDONR221 MGC03-A03 BC040567 ENST00000314761  
HGE091141 M01C027O05 pDONR221 MGC03-A03 BC040567 ENST00000314761  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR402877 RBdS007D05 pGCAP10 NM_032168.1  
GATTCCGCTACTGCGCAAAGATGGTGGAGGAGGAGAACATCCGCGTGGTTCGTTGTGGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl