Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08805

HP ID(1) HP08805
Gene ID(2) 5528
Gene Symbol finder PPP2R5D
Protein Name protein phosphatase 2, regulatory subunit B', delta isoform
RefSeq NM_006245.2
Length of RefSeq (bp) 2975
Chromosome 6p21.1
Reference DDBJ accession
UniGene Hs.533308

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS007D04 pGCAP10 GAGCGCGCAGGCGGTGGCGAAGAGACGCCGAGCGGGCCGAGTGCGGCCGAGCAAAGCCGG
RBdS014M14 pGCAP10 GGAGCGGGCCGAGTGCGGCCGAGCAAAGCCGGAGCCGGAGCGGGGCCGCAGGAGACGGGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl