Prev. |  KEGG KO K11584 > 

RIKEN DNA Bank Human Resource - PPP2R5D

Gene ID NCBI Gene 5528 |  KEGG hsa:5528
Gene Symbol PPP2R5D
Protein Name protein phosphatase 2 regulatory subunit B'delta
Synonyms B56D|B56delta|MRD35
Featured content Sphingolipid signaling pathway (human)
Ortholog resource in our bank

  PPP2R5D

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX005240 IRAK013B16 pCMV-SPORT6 BC010692 NM_006245 Full
HGY082589 IRAL006H21 pOTB7 BC001175 NM_180977
HGY082862 IRAL007C14 pOTB7 BC001095 NM_006245 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE037722 W01A094F02 pENTR-TOPO IRAL007C14 BC001095 NM_006245  
HGE037728 W01A094F08 pENTR-TOPO IRAL007C14 BC001095 NM_006245  
HGE038017 W01A095A17 pENTR-TOPO IRAL007C14 BC001095 NM_006245  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR402876 RBdS007D04 pGCAP10 NM_006245.2  
GAGCGCGCAGGCGGTGGCGAAGAGACGCCGAGCGGGCCGAGTGCGGCCGAGCAAAGCCGG
HKR405902 RBdS014M14 pGCAP10 NM_006245.2  
GGAGCGGGCCGAGTGCGGCCGAGCAAAGCCGGAGCCGGAGCGGGGCCGCAGGAGACGGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl