Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08803

HP ID(1) HP08803
Gene ID(2) 55028
Gene Symbol finder C17orf80
Protein Name chromosome 17 open reading frame 80
RefSeq NM_001100621.1
Length of RefSeq (bp) 3545
Chromosome 17q25.1
Reference DDBJ accession
UniGene Hs.12929

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS007C08 pGCAP10 GACGCGGTTCCTTGGCCGGGGGTTGGGCAGGGGCCTGGGGGGCTTCCCTGGGGGGCTTGT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl