Prev. | 

RIKEN DNA Bank Human Resource - C17orf80

Gene ID NCBI Gene 55028 |  KEGG hsa:55028
Gene Symbol C17orf80
Protein Name chromosome 17 open reading frame 80
Synonyms HLC-8|MIG3|SPEP1
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY083518 IRAL008N06 pOTB7 BC005005 NM_017941

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE097613 M01C044A13 pDONR221 MGC11-E07 BC005005 ENST00000359042  
HGE097661 M01C044C13 pDONR221 MGC11-E07 BC005005 ENST00000359042  
HGE097709 M01C044E13 pDONR221 MGC11-E07 BC005005 ENST00000359042  
HGE097757 M01C044G13 pDONR221 MGC11-E07 BC005005 ENST00000359042  
HGE097805 M01C044I13 pDONR221 MGC11-E07 BC005005 ENST00000359042  
HGE097853 M01C044K13 pDONR221 MGC11-E07 BC005005 ENST00000359042  
HGE097901 M01C044M13 pDONR221 MGC11-E07 BC005005 ENST00000359042  
HGE097949 M01C044O13 pDONR221 MGC11-E07 BC005005 ENST00000359042  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR402856 RBdS007C08 pGCAP10 NM_001100621.1  
GACGCGGTTCCTTGGCCGGGGGTTGGGCAGGGGCCTGGGGGGCTTCCCTGGGGGGCTTGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl