Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08802

HP ID(1) HP08802
Gene ID(2) 96764
Gene Symbol finder TGS1
Protein Name trimethylguanosine synthase homolog (S. cerevisiae)
RefSeq NM_024831.6
Length of RefSeq (bp) 3708
Chromosome 8q11
Reference DDBJ accession
UniGene Hs.335068

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS007C03 pGCAP10 AGTTTCTATCTCCTCATCCAGGGCTTGCGGGCGAGGCCTGTTTTAAGTCTCCAGTAACCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl