Prev. |  KEGG KO K14292 > 

RIKEN DNA Bank Human Resource - TGS1

Gene ID NCBI Gene 96764 |  KEGG hsa:96764
Gene Symbol TGS1
Protein Name trimethylguanosine synthase 1
Synonyms NCOA6IP|PIMT|PIPMT
Ortholog resource in our bank

  TGS1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR402851 RBdS007C03 pGCAP10 NM_024831.6  
AGTTTCTATCTCCTCATCCAGGGCTTGCGGGCGAGGCCTGTTTTAAGTCTCCAGTAACCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl