Prev. | NRCD Clone O | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08798

HP ID(1) HP08798
Gene ID(2) 116448
Gene Symbol finder OLIG1
Protein Name oligodendrocyte transcription factor 1
RefSeq NM_138983.1
Length of RefSeq (bp) 2168
Chromosome 21q22.11
Reference DDBJ accession
UniGene Hs.56663

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS007A05 pGCAP10 GGACGGCCCCCCTCCTCCCCAAGGCTGCGCGCGAGAAGCCGGAGGCGCCGGCCGANCCTC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl