Prev. |  KEGG KO K09085 > 

RIKEN DNA Bank Human Resource - OLIG1

Gene ID NCBI Gene 116448 |  KEGG hsa:116448
Gene Symbol OLIG1
Protein Name oligodendrocyte transcription factor 1
Synonyms BHLHB6|BHLHE21
Ortholog resources KEGG ortholog (KEGG orthology K09085) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX007672 IRAK019C24 pCMV-SPORT6 BC011252 NM_138983 Partial/var
HGX011959 IRAK029O23 pCMV-SPORT6 BC033290 NM_138983 Full
HGX017009 IRAK042I17 pCMV-SPORT6 BC026989 NM_138983

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE047884 W01A119L20 pENTR-TOPO IRAK029O23 BC033290 NM_138983  
HGE047888 W01A119L24 pENTR-TOPO IRAK029O23 BC033290 NM_138983  

♦ W series clone contains a stop codon.

GNP_entry_W01A_210404.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR402805 RBdS007A05 pGCAP10 NM_138983.1  
GGACGGCCCCCCTCCTCCCCAAGGCTGCGCGCGAGAAGCCGGAGGCGCCGGCCGANCCTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_210404.csv
NRCDhumcloneList_RB_210404.csv


2021.04.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_210329.pl