Prev. | NRCD Clone V | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08789

HP ID(1) HP08789
Gene ID(2) 23339
Gene Symbol finder VPS39
Protein Name vacuolar protein sorting 39 homolog (S. cerevisiae)
RefSeq NM_015289.2
Length of RefSeq (bp) 4851
Chromosome 15q15.1
Reference DDBJ accession
UniGene Hs.88025

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd98E02 pGCAP10 GGGGGTTGACGATGGCTGTGTTGTTGAAGGGCCTGTAGCCGGGGGGTTCCTGGCCGGATC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl