Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08731

HP ID(1) HP08731
Gene ID(2) 2889
Gene Symbol finder RAPGEF1
Protein Name Rap guanine nucleotide exchange factor (GEF) 1
RefSeq NM_005312.2
Length of RefSeq (bp) 6121
Chromosome 9q34.3
Reference DDBJ accession
UniGene Hs.127897

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd90F06 pGCAP10 CGGCCGGCCGATGGCGGCCGAGGCCCGGCGGGCGGGCGGGCGGCGTCGCTGCGCTGCGGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl