Prev. | NRCD Clone U | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08726

HP ID(1) HP08726
Gene ID(2) 55585
Gene Symbol finder UBE2Q1
Protein Name ubiquitin-conjugating enzyme E2Q (putative) 1
RefSeq NM_017582.6
Length of RefSeq (bp) 3223
Chromosome 1q21.3
Reference DDBJ accession
UniGene Hs.607928

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd58E07 pGCAP10 GGGGGGGGCCAGCGAGCGGAGGGGGGGGCCTGTCCCGGANNNNNTTNNNNNGCGCCATCT
RBd89H02 pGCAP10 GGAGGGGGGGGCCTGTCCCGGAGGTGGCGGCGGCGCCATCTTGGCGAAGGGGGGATCAGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl