Prev. |  KEGG KO K10582 > 

RIKEN DNA Bank Human Resource - UBE2Q1

Gene ID NCBI Gene 55585 |  KEGG hsa:55585
Gene Symbol UBE2Q1
Protein Name ubiquitin conjugating enzyme E2 Q1
Synonyms GTAP|NICE-5|NICE5|PRO3094|UBE2Q
Ortholog resource in our bank

  UBE2Q1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Individualy Deposited Resource

Catalog number Name of Resource Description
RDB04543 SEREX clone NGO-Co-25 (ID 2262-3) #1 SEREX clone NGO-Co-25 (ID 2262-3) #1

webcatalog20220516.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001798 IRAK004I06 pCMV-SPORT6 BC000848 NM_017582 Partial
HGX056618 IRAK141J02 pCMV-SPORT6 BC061583 NM_017582 Partial
HGY088040 IRAL020B16 pOTB7 BC009286 NM_017582 Partial
HGY103107 IRAL057M19 pDNR-LIB BC070158 NM_017582 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Jun29.csv
GNP_full_IRAL_2023Jun29.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR383303 RBd58E07 pGCAP10 NM_017582.6  
GGGGGGGGCCAGCGAGCGGAGGGGGGGGCCTGTCCCGGANNNNNTTNNNNNGCGCCATCT
HKR395770 RBd89H02 pGCAP10 NM_017582.6  
GGAGGGGGGGGCCTGTCCCGGAGGTGGCGGCGGCGCCATCTTGGCGAAGGGGGGATCAGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.10.11

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl