Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08714

HP ID(1) HP08714
Gene ID(2) 10181
Gene Symbol finder RBM5
Protein Name RNA binding motif protein 5
RefSeq NM_005778.1
Length of RefSeq (bp) 3135
Chromosome 3p21.3
Reference DDBJ accession
UniGene

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd88E02 pGCAP10 GGTCGGCGGAGGCGCCATTTTGTGTAGCCGCCGAACCTTGTTGGAGGTTCTGGGGCGCAG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl