Prev. | NRCD Clone U | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08707

HP ID(1) HP08707
Gene ID(2) 8433
Gene Symbol finder UTF1
Protein Name undifferentiated embryonic cell transcription factor 1
RefSeq NM_003577.2
Length of RefSeq (bp) 1157
Chromosome 10q26
Reference DDBJ accession
UniGene Hs.458406

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd87F08 pGCAP10 GAGACGCCACCCCGCTGCCCACCGCCCGCGACCGCGACGCGGACCCCACCTGGACGCTCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl