Prev. | 

RIKEN DNA Bank Human Resource - UTF1

Gene ID NCBI Gene 8433 |  KEGG hsa:8433
Gene Symbol UTF1
Protein Name undifferentiated embryonic cell transcription factor 1
Synonyms -
Links

  KEGG gene

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB07034 phUTF1tk-luc Reporter construct of human UTF1 3'-enhancer.

RDB_org_190226.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR394928 RBd87F08 pGCAP10 NM_003577.2  
GAGACGCCACCCCGCTGCCCACCGCCCGCGACCGCGACGCGGACCCCACCTGGACGCTCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl