Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08697

HP ID(1) HP08697
Gene ID(2) 54873
Gene Symbol finder PALMD
Protein Name palmdelphin
RefSeq NM_017734.3
Length of RefSeq (bp) 2577
Chromosome 1p22-p21
Reference DDBJ accession
UniGene Hs.483993

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd85E12 pGCAP10 GGGGAATTTCTCTATTTCTCCACTGGTGCAAAGAGCGGATTTCTCCCTGCTTCTCTTCTG
RBdS022I21 pGCAP10 GGGAATTTCTCTATTTCTCCACTGGTGCAAAGAGCGGATTTCTCCCTGCTTCTCTTCTGT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl