Prev. |  KEGG KO K16519 > 

RIKEN DNA Bank Human Resource - PALMD

Gene ID NCBI Gene 54873 |  KEGG hsa:54873
Gene Symbol PALMD
Protein Name palmdelphin
Synonyms C1orf11|PALML
Ortholog resources KEGG ortholog (KEGG orthology K16519) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY087767 IRAL019G23 pDNR-LIB BC012570 NM_017734 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR394108 RBd85E12 pGCAP10 NM_017734.3  
GGGGAATTTCTCTATTTCTCCACTGGTGCAAAGAGCGGATTTCTCCCTGCTTCTCTTCTG
HKR409013 RBdS022I21 pGCAP10 NM_017734.3  
GGGAATTTCTCTATTTCTCCACTGGTGCAAAGAGCGGATTTCTCCCTGCTTCTCTTCTGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl