Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08689

HP ID(1) HP08689
Gene ID(2) 80742
Gene Symbol finder PRR3
Protein Name proline rich 3
RefSeq NM_001077497.1
Length of RefSeq (bp) 2778
Chromosome 6p21.33
Reference DDBJ accession
UniGene Hs.118354

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd84B06 pGCAP10 GCCCTTCCTCACTACCCTCCAAATCCCGCTGCAGCCATTGCCGCAGACACGATGCCGAAA
RBdS015G14 pGCAP10 GGTGCCCCTTCCTCACTACCCTCCAAATCCCGCTGCAGCCATTGCCGCAGACACGATGCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl