Prev. | 

RIKEN DNA Bank Human Resource - PRR3

Gene ID NCBI Gene 80742 |  KEGG hsa:80742
Gene Symbol PRR3
Protein Name proline rich 3
Synonyms CAT56
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE013281 W01A033D09 pENTR-TOPO flj0073j10 AK131382 NM_025263  
HGE013283 W01A033D11 pENTR-TOPO flj0073j10 AK131382 NM_025263  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR393630 RBd84B06 pGCAP10 NM_001077497.1  
GCCCTTCCTCACTACCCTCCAAATCCCGCTGCAGCCATTGCCGCAGACACGATGCCGAAA
HKR406158 RBdS015G14 pGCAP10 NM_001077497.1  
GGTGCCCCTTCCTCACTACCCTCCAAATCCCGCTGCAGCCATTGCCGCAGACACGATGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl