Prev. | NRCD Clone K | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08681

HP ID(1) HP08681
Gene ID(2) 57613
Gene Symbol finder KIAA1467
Protein Name KIAA1467
RefSeq NM_020853.1
Length of RefSeq (bp) 4725
Chromosome 12p13.1
Reference DDBJ accession
UniGene Hs.132660

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd83A09 pGCAP10 GACCGGGGCCTCAGCCATGGCGACCGTGCTGTCCAGGGCGCTCAAGCTGCCGGGGAAGAA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl