Prev. | 

RIKEN DNA Bank Human Resource - FAM234B

Gene ID NCBI Gene 57613 |  KEGG hsa:57613
Gene Symbol FAM234B
Protein Name family with sequence similarity 234 member B
Synonyms KIAA1467
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE105222 M01C063A22 pDONR221 06_06-B11 AK125278 NM_020853  
HGE105270 M01C063C22 pDONR221 06_06-B11 AK125278 NM_020853  
HGE105318 M01C063E22 pDONR221 06_06-B11 AK125278 NM_020853  
HGE105366 M01C063G22 pDONR221 06_06-B11 AK125278 NM_020853  
HGE105414 M01C063I22 pDONR221 06_06-B11 AK125278 NM_020853  
HGE105462 M01C063K22 pDONR221 06_06-B11 AK125278 NM_020853  
HGE105510 M01C063M22 pDONR221 06_06-B11 AK125278 NM_020853  
HGE105558 M01C063O22 pDONR221 06_06-B11 AK125278 NM_020853  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR393209 RBd83A09 pGCAP10 NM_020853.1  
GACCGGGGCCTCAGCCATGGCGACCGTGCTGTCCAGGGCGCTCAAGCTGCCGGGGAAGAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl