Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08671

HP ID(1) HP08671
Gene ID(2) 55621
Gene Symbol finder TRMT1
Protein Name TRM1 tRNA methyltransferase 1 homolog (S. cerevisiae)
RefSeq NM_017722.2
Length of RefSeq (bp) 2217
Chromosome 19p13.13
Reference DDBJ accession
UniGene Hs.515169

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd81D09 pGCAP10 AATTCGGTTTTCTGTGGCTACGAGAGCAGGCTTGGCGGGCGGAGGCGCCAGCGGATGTCT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl