Prev. |  KEGG KO K00555 > 

RIKEN DNA Bank Human Resource - TRMT1

Gene ID NCBI Gene 55621 |  KEGG hsa:55621
Gene Symbol TRMT1
Protein Name tRNA methyltransferase 1
Synonyms MRT68|TRM1
Ortholog resource in our bank

  TRMT1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX007789 IRAK019H21 pCMV-SPORT6 BC018302 NM_017722 Full/var
HGX033835 IRAK084J19 pCMV-SPORT6 BC040126 NM_017722
HGY081663 IRAL004C15 pOTB7 BC002492 NM_017722 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR392481 RBd81D09 pGCAP10 NM_017722.2  
AATTCGGTTTTCTGTGGCTACGAGAGCAGGCTTGGCGGGCGGAGGCGCCAGCGGATGTCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl