Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08669

HP ID(1) HP08669
Gene ID(2) 51701
Gene Symbol finder NLK
Protein Name nemo-like kinase
RefSeq NM_016231.4
Length of RefSeq (bp) 3555
Chromosome 17q11.2
Reference DDBJ accession
UniGene Hs.208759

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd81C09 pGCAP10 GGAGGTGAGTCCGGCCGCGGCGGAACCGGCGGCTGAGGAGGCGGCGGCTGAGGAGAAGGC
RBdS187J06 pGCAP10 GGAGGAGAAGGCGGCCGCGGCGGCTGAGGAGAAAGCGGCCGCGGGGACGGAAGCCGGGTG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl