Prev. |  KEGG KO K04468 > 

RIKEN DNA Bank Human Resource - NLK

Gene ID NCBI Gene 51701 |  KEGG hsa:51701
Gene Symbol NLK
Protein Name nemo like kinase
Synonyms -
Featured content Wnt signaling pathway (human)
Ortholog resource in our bank

  NLK

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX044366 IRAK110P06 pCMV-SPORT6 BC064663 NM_016231 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE039008 W01A097I16 pENTR-TOPO IRAK110P06 BC064663 NM_016231  
HGE039010 W01A097I18 pENTR-TOPO IRAK110P06 BC064663 NM_016231  
HGE039046 W01A097K06 pENTR-TOPO IRAK110P06 BC064663 NM_016231  
HGE039048 W01A097K08 pENTR-TOPO IRAK110P06 BC064663 NM_016231  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR392457 RBd81C09 pGCAP10 NM_016231.4  
GGAGGTGAGTCCGGCCGCGGCGGAACCGGCGGCTGAGGAGGCGGCGGCTGAGGAGAAGGC
HKR475022 RBdS187J06 pGCAP10 NM_016231.4  
GGAGGAGAAGGCGGCCGCGGCGGCTGAGGAGAAAGCGGCCGCGGGGACGGAAGCCGGGTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl