Prev. | NRCD Clone K | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08643

HP ID(1) HP08643
Gene ID(2) 9897
Gene Symbol finder KIAA0196
Protein Name KIAA0196
RefSeq NM_014846.3
Length of RefSeq (bp) 4173
Chromosome 8q24.13
Reference DDBJ accession
UniGene Hs.270043

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd76G06 pGCAP10 GGCGGATAGAAGAGGACCGCCGCCTTGAGGGAGGGGTGGAAACTGGGTGCCGGCTCCGCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl