Prev. |  KEGG KO K18464 > 

RIKEN DNA Bank Human Resource - WASHC5

Gene ID NCBI Gene 9897 |  KEGG hsa:9897
Gene Symbol WASHC5
Protein Name WASH complex subunit 5
Synonyms KIAA0196|RTSC|RTSC1|SPG8
Featured content Endocytosis (human)
Ortholog resource in our bank

  WASHC5

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX008759 IRAK021O23 pCMV-SPORT6 BC026951 NM_014846 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE080448 M01C001B24 pDONR221 04-134-2_1-D12 BC026951 ENST00000318410  
HGE080496 M01C001D24 pDONR221 04-134-2_1-D12 BC026951 ENST00000318410  
HGE080544 M01C001F24 pDONR221 04-134-2_1-D12 BC026951 ENST00000318410  
HGE080592 M01C001H24 pDONR221 04-134-2_1-D12 BC026951 ENST00000318410  
HGE080640 M01C001J24 pDONR221 04-134-2_1-D12 BC026951 ENST00000318410  
HGE080688 M01C001L24 pDONR221 04-134-2_1-D12 BC026951 ENST00000318410  
HGE080736 M01C001N24 pDONR221 04-134-2_1-D12 BC026951 ENST00000318410  
HGE080784 M01C001P24 pDONR221 04-134-2_1-D12 BC026951 ENST00000318410  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR390550 RBd76G06 pGCAP10 NM_014846.3  
GGCGGATAGAAGAGGACCGCCGCCTTGAGGGAGGGGTGGAAACTGGGTGCCGGCTCCGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl