Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08631

HP ID(1) HP08631
Gene ID(2) 54517
Gene Symbol finder PUS7
Protein Name pseudouridylate synthase 7 homolog (S. cerevisiae)
RefSeq NM_019042.3
Length of RefSeq (bp) 3484
Chromosome 7q22.2
Reference DDBJ accession
UniGene Hs.520619

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd74F07 pGCAP10 GAGTCGGGCCGCGGCGCGTCGCTGCGCCGCACGTGTGCGAGCCCGGCCGCCGGTGAGTCG
RBdS081J08 pGCAP10

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl