Prev. |  KEGG KO K06176 > 

RIKEN DNA Bank Human Resource - PUS7

Gene ID NCBI Gene 54517 |  KEGG hsa:54517
Gene Symbol PUS7
Protein Name pseudouridine synthase 7
Synonyms IDDABS
Ortholog resource in our bank

  PUS7

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX005417 IRAK013J01 pCMV-SPORT6 BC011396 NM_019042 Full
HGY086509 IRAL016E13 pDNR-LIB BC005209 NM_019042 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR389727 RBd74F07 pGCAP10 NM_019042.3  
GAGTCGGGCCGCGGCGCGTCGCTGCGCCGCACGTGTGCGAGCCCGGCCGCCGGTGAGTCG
HKR432624 RBdS081J08 pGCAP10 NM_019042.3  

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl