Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08630

HP ID(1) HP08630
Gene ID(2) 5534
Gene Symbol finder PPP3R1
Protein Name protein phosphatase 3 (formerly 2B), regulatory subunit B, 19kDa, alpha isoform (calcineurin B, type I)
RefSeq NM_000945.3
Length of RefSeq (bp) 3111
Chromosome 2p15
Reference DDBJ accession
UniGene Hs.280604

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd74E02 pGCAP10 GAGCTCCGCCCTCCCCTTTTTTCGTGCCTTGAGGTTGCGGGTCAGCGCGAGCCGCTGCAG
RBd79C07 pGCAP10 CGGCCGGNCGATGCCGCGCGCGCCCCCGCCTCCGCCCCGCGCGCTGCAGCACTCCGCTTT
RBd86G06 pGCAP10 GGCCTTGAGGTTGCGGGTCAGCGCGAGCCGCTGCAGTGAGTCCGTCACGGCTCCGGCGCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl