Prev. |  KEGG KO K06268 > 

RIKEN DNA Bank Human Resource - PPP3R1

Gene ID NCBI Gene 5534 |  KEGG hsa:5534
Gene Symbol PPP3R1
Protein Name protein phosphatase 3 regulatory subunit B, alpha
Synonyms CALNB1|CNB|CNB1
Ortholog resources KEGG ortholog (KEGG orthology K06268) in the DNA Bank
Featured content Wnt signaling pathway (human)
Featured content T cell receptor signaling pathway (human)
Featured content B cell receptor signaling pathway (human)
Featured content Axon guidance - human
Featured content Alzheimer disease - human
Featured content Amyotrophic lateral sclerosis (ALS) - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX019827 IRAK049J11 pCMV-SPORT6 BC027913 NM_000945 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR389698 RBd74E02 pGCAP10 NM_000945.3  
GAGCTCCGCCCTCCCCTTTTTTCGTGCCTTGAGGTTGCGGGTCAGCGCGAGCCGCTGCAG
HKR391655 RBd79C07 pGCAP10 NM_000945.3  
CGGCCGGNCGATGCCGCGCGCGCCCCCGCCTCCGCCCCGCGCGCTGCAGCACTCCGCTTT
HKR394550 RBd86G06 pGCAP10 NM_000945.3  
GGCCTTGAGGTTGCGGGTCAGCGCGAGCCGCTGCAGTGAGTCCGTCACGGCTCCGGCGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.05.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl