DNA Bank Top |  KEGG KO K06268 > 

RIKEN DNA Bank Human Resource - PPP3R1

Gene ID NCBI Gene 5534 |  KEGG hsa:5534
Gene Symbol PPP3R1
Protein Name protein phosphatase 3 regulatory subunit B, alpha
Synonyms CALNB1|CNB|CNB1
Featured content Wnt signaling pathway (human)
Featured content T cell receptor signaling pathway (human)
Featured content B cell receptor signaling pathway (human)
Featured content Axon guidance - human
Featured content Alzheimer disease - human
Featured content Amyotrophic lateral sclerosis (ALS) - human

Link

Ortholog resource in our bank

  PPP3R1

External database

human PPP3R1

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB19405 pCAG-hPPP3R1 Expression vector of human PPP3R1.    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX019827 IRAK049J11 pCMV-SPORT6 BC027913 NM_000945 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR389698 RBd74E02 pGCAP10 NM_000945.3  
GAGCTCCGCCCTCCCCTTTTTTCGTGCCTTGAGGTTGCGGGTCAGCGCGAGCCGCTGCAG
HKR391655 RBd79C07 pGCAP10 NM_000945.3  
CGGCCGGNCGATGCCGCGCGCGCCCCCGCCTCCGCCCCGCGCGCTGCAGCACTCCGCTTT
HKR394550 RBd86G06 pGCAP10 NM_000945.3  
GGCCTTGAGGTTGCGGGTCAGCGCGAGCCGCTGCAGTGAGTCCGTCACGGCTCCGGCGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv

2024.10.04

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl