Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08599

HP ID(1) HP08599
Gene ID(2) 9967
Gene Symbol finder THRAP3
Protein Name thyroid hormone receptor associated protein 3
RefSeq NM_005119.3
Length of RefSeq (bp) 4447
Chromosome 1p34.3
Reference DDBJ accession
UniGene Hs.160211

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd70E09 pGCAP10 GGGGCTGGTTGTTCCGTTGCGAGCTGCAGCTGCGATCTCTGTGGTAGGCCCAGAAGTGTA
RBd97D05 pGCAP10 GGCGCTGTGGGGCGGGGGCGAGGTTCGGGCTGGTTGTTCCGTTGCGAGCTGCAGCTGCGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl