Prev. |  KEGG KO K13112 > 

RIKEN DNA Bank Human Resource - THRAP3

Gene ID NCBI Gene 9967 |  KEGG hsa:9967
Gene Symbol THRAP3
Protein Name thyroid hormone receptor associated protein 3
Synonyms BCLAF2|TRAP150
Ortholog resource in our bank

  THRAP3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX025656 IRAK064C08 pCMV-SPORT6 BC037554 NM_005119 Partial/var
HGX047891 IRAK119M03 pCMV-SPORT6 BC054046 NM_005119 Partial/var
HGX056001 IRAK140A01 pCMV-SPORT6 BC065519 NM_005119 Partial/var
HGY081749 IRAL004G05 pOTB7 BC002501 NM_005119 Partial/var
HGY090259 IRAL025K19 pOTB7 BC010997 NM_005119 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR388105 RBd70E09 pGCAP10 NM_005119.3  
GGGGCTGGTTGTTCCGTTGCGAGCTGCAGCTGCGATCTCTGTGGTAGGCCCAGAAGTGTA
HKR398877 RBd97D05 pGCAP10 NM_005119.3  
GGCGCTGTGGGGCGGGGGCGAGGTTCGGGCTGGTTGTTCCGTTGCGAGCTGCAGCTGCGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl