Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08598

HP ID(1) HP08598
Gene ID(2) 25807
Gene Symbol finder RHBDD3
Protein Name rhomboid domain containing 3
RefSeq NM_012265.1
Length of RefSeq (bp) 1738
Chromosome 22q12.1-q12.2
Reference DDBJ accession
UniGene Hs.106730

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd70E07 pGCAP10 GACTAATCCGCGGGCCGCGGGGAATGGGTGGCGCGCCAGCCGGTCGGCAGGGGTCACGCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl