Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08597

HP ID(1) HP08597
Gene ID(2) 56652
Gene Symbol finder C10orf2
Protein Name chromosome 10 open reading frame 2
RefSeq NM_021830.3
Length of RefSeq (bp) 3630
Chromosome 10q23.3-24.3
Reference DDBJ accession
UniGene Hs.22678

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd57G02 pGCAP10 GAGTTTTGCTTCCGAGGTCAAGGCGAGTAGCATGTGCGGGAGACTCACGTTGCCGGCGAA
RBd70D10 pGCAP10 TGTTTTTGCTTCCGAGGTCAAGGCGAGTAGCATGTGCGGGAGACTCACGTTGCCGGCGAA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl