Prev. |  KEGG KO K17680 > 

RIKEN DNA Bank Human Resource - TWNK

Gene ID NCBI Gene 56652 |  KEGG hsa:56652
Gene Symbol TWNK
Protein Name twinkle mtDNA helicase
Synonyms ATXN8|C10orf2|IOSCA|MTDPS7|PEO|PEO1|PEOA3|PRLTS5|SANDO|SCA8|TWINL
Ortholog resource in our bank

  TWNK

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX027233 IRAK068B09 pCMV-SPORT6 BC033762 NM_021830 Partial
HGY090222 IRAL025J06 pOTB7 BC013349 NM_021830 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR382946 RBd57G02 pGCAP10 NM_021830.3  
GAGTTTTGCTTCCGAGGTCAAGGCGAGTAGCATGTGCGGGAGACTCACGTTGCCGGCGAA
HKR388082 RBd70D10 pGCAP10 NM_021830.3  
TGTTTTTGCTTCCGAGGTCAAGGCGAGTAGCATGTGCGGGAGACTCACGTTGCCGGCGAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl