Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08591

HP ID(1) HP08591
Gene ID(2) 134701
Gene Symbol finder C6orf159
Protein Name chromosome 6 open reading frame 159
RefSeq NM_001009994.1
Length of RefSeq (bp) 664
Chromosome 6q14.2
Reference DDBJ accession
UniGene Hs.149454

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd69G05 pGCAP10 GGGGCGGAGAGGCAGCGAACCTCTCAATGTGCAGCAGGCCGCGAGGGCTATATAAAGCTC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl