Prev. | 

RIKEN DNA Bank Human Resource - RIPPLY2

Gene ID NCBI Gene 134701 |  KEGG hsa:134701
Gene Symbol RIPPLY2
Protein Name ripply transcriptional repressor 2
Synonyms C6orf159|SCDO6|dJ237I15.1
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR387749 RBd69G05 pGCAP10 NM_001009994.1  
GGGGCGGAGAGGCAGCGAACCTCTCAATGTGCAGCAGGCCGCGAGGGCTATATAAAGCTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl