Prev. | NRCD Clone U | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08565

HP ID(1) HP08565
Gene ID(2) 7390
Gene Symbol finder UROS
Protein Name uroporphyrinogen III synthase (congenital erythropoietic porphyria)
RefSeq NM_000375.2
Length of RefSeq (bp) 1371
Chromosome 10q25.2-q26.3
Reference DDBJ accession
UniGene Hs.501376

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd65D12 pGCAP10 GAGTCTGAGGTGCGGGGTCCTGGGGCCCGGCGCGGGTGGCCGCCGCGGCCCCTCGGGCTG
RBdS187N01 pGCAP10 TTGGCCTAGCTGCGCGCAGCCACCCACGCGACCCCAGTCTGAGGTGCGGGGTCCTGGGGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl