Prev. |  KEGG KO K01719 > 

RIKEN DNA Bank Human Resource - UROS

Gene ID NCBI Gene 7390 |  KEGG hsa:7390
Gene Symbol UROS
Protein Name uroporphyrinogen III synthase
Synonyms UROIIIS
Ortholog resource in our bank

  UROS

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY081642 IRAL004B18 pOTB7 BC002573 NM_000375 Full
HGY085554 IRAL013O18 pOTB7 BC004338 NM_000375

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR386084 RBd65D12 pGCAP10 NM_000375.2  
GAGTCTGAGGTGCGGGGTCCTGGGGCCCGGCGCGGGTGGCCGCCGCGGCCCCTCGGGCTG
HKR475113 RBdS187N01 pGCAP10 NM_000375.2  
TTGGCCTAGCTGCGCGCAGCCACCCACGCGACCCCAGTCTGAGGTGCGGGGTCCTGGGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl