Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08562

HP ID(1) HP08562
Gene ID(2) 5934
Gene Symbol finder RBL2
Protein Name retinoblastoma-like 2 (p130)
RefSeq NM_005611.2
Length of RefSeq (bp) 4853
Chromosome 16q12.2
Reference DDBJ accession
UniGene Hs.513609

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd65B05 pGCAP10 GGTCGTTTGCGGCGGCGCAGGCGCGGTGCGGGCGGCGGACGGGCGGGCGCTTCGCCGTTT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl