Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP08559

HP ID(1) HP08559
Gene ID(2) 5130
Gene Symbol finder PCYT1A
Protein Name phosphate cytidylyltransferase 1, choline, alpha
RefSeq NM_005017.2
Length of RefSeq (bp) 1677
Chromosome 3q29
Reference DDBJ accession
UniGene Hs.435767

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd64F10 pGCAP10 GAGGCGGAACTTCCGGCTGGCTCTTCCATCAGCTGCCTTCCCCGGGCGTCTCCCCGCAAC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl