Prev. |  KEGG KO K00968 > 

RIKEN DNA Bank Human Resource - PCYT1A

Gene ID NCBI Gene 5130 |  KEGG hsa:5130
Gene Symbol PCYT1A
Protein Name phosphate cytidylyltransferase 1, choline, alpha
Synonyms CCTA|CT|CTA|CTPCT|PCYT1|SMDCRD
Ortholog resources KEGG ortholog (KEGG orthology K00968) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX035757 IRAK089G13 pCMV-SPORT6 BC046355 NM_005017

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE014474 W01A036D02 pENTR-TOPO IRAK089G13 BC046355 NM_005017  
HGE014476 W01A036D04 pENTR-TOPO IRAK089G13 BC046355 NM_005017  
HGE014480 W01A036D08 pENTR-TOPO IRAK089G13 BC046355 NM_005017  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR385730 RBd64F10 pGCAP10 NM_005017.2  
GAGGCGGAACTTCCGGCTGGCTCTTCCATCAGCTGCCTTCCCCGGGCGTCTCCCCGCAAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl